2026 fragmentase (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
98
Structured Review
New England Biolabs
2026 fragmentase
2026 Fragmentase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 753 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nebnext+dsdna+fragmentase/NEBNext+dsDNA+Fragmentase/pm42872712-116-4-6
Average 98 stars, based on 753 article reviews
2026 Fragmentase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 753 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nebnext+dsdna+fragmentase/NEBNext+dsDNA+Fragmentase/pm42872712-116-4-6
Average 98 stars, based on 753 article reviews
2026 fragmentase - by Bioz Stars,
2026-10
98/100 stars
Images
Related Articles
Sequencing:Article Title: Eupentacta fraudatrix: the first chromosome-level holothurian genome with extraordinarily high heterozygosity. Article Snippet: .. Chromosome conformation-captured DNA (3 AR TI CL E IN P RE SS μg) was prepared for sequencing on DNBSEQ-G50 in the PE160 mode with a MGIEasy Universal DNA Library Prep Kit and Article Title: Whole-genome sequence dataset of Pasteurella multocida strain EH32 isolated from buffaloes in Vietnam Article Snippet: .. Data collection , Genomic DNA of P. multocida strain EH32 was extracted from pure cultures using the QIAamp DNA Mini Kit. Sequencing libraries were prepared with the Article Title: Whole-genome sequence dataset of Pasteurella multocida strain EH32 isolated from buffaloes in Vietnam Article Snippet: The P. multocida strain EH32 was cultured on blood agar and incubated at 37 °C for 24 h. Genomic DNA was extracted using the QIAamp DNA Mini Kit (Qiagen, USA) according to the manufacturer’s instructions. .. Whole-genome sequencing libraries were prepared using the Binding Assay:Article Title: NAP-seq for full-length noncapped RNA sequencing. Article Snippet: The majority of the mammalian genome is transcribed into RNAs, most of which are noncapped RNAs (napRNAs) that not only regulate diverse biological processes through their functions as noncoding RNAs but also serve as processing products to delineate specific RNA biogenesis pathways.. However, due to their heterogeneous lengths, diverse terminal modifications and complex secondary structures, identifying these napRNAs poses substantial challenges.. Recently, we developed a napRNA sequencing technique (NAP-seq) to identify full-length sequences of napRNAs with various terminal modifications at single-nucleotide resolution. Reverse Transcription:Article Title: NAP-seq for full-length noncapped RNA sequencing. Article Snippet: The majority of the mammalian genome is transcribed into RNAs, most of which are noncapped RNAs (napRNAs) that not only regulate diverse biological processes through their functions as noncoding RNAs but also serve as processing products to delineate specific RNA biogenesis pathways.. However, due to their heterogeneous lengths, diverse terminal modifications and complex secondary structures, identifying these napRNAs poses substantial challenges.. Recently, we developed a napRNA sequencing technique (NAP-seq) to identify full-length sequences of napRNAs with various terminal modifications at single-nucleotide resolution. Ligation:Article Title: NAP-seq for full-length noncapped RNA sequencing. Article Snippet: The majority of the mammalian genome is transcribed into RNAs, most of which are noncapped RNAs (napRNAs) that not only regulate diverse biological processes through their functions as noncoding RNAs but also serve as processing products to delineate specific RNA biogenesis pathways.. However, due to their heterogeneous lengths, diverse terminal modifications and complex secondary structures, identifying these napRNAs poses substantial challenges.. Recently, we developed a napRNA sequencing technique (NAP-seq) to identify full-length sequences of napRNAs with various terminal modifications at single-nucleotide resolution. Functional Assay:Article Title: Whole-genome sequence dataset of Pasteurella multocida strain EH32 isolated from buffaloes in Vietnam Article Snippet: .. Data collection , Genomic DNA of P. multocida strain EH32 was extracted from pure cultures using the QIAamp DNA Mini Kit. Sequencing libraries were prepared with the Enzymatic Fragmentation:Article Title: Genome-wide identification of differentially methylated regions in prefrontal cortex of suicide completers in an Indian ancestral admixture population. Article Snippet: Objectives: Suicide is a complex phenotype influenced by genetic, environmental, and psychosocial determinants.. Epigenetic mechanisms, particularly DNA methylation, play a critical role in mediating the long-term effects of environmental stressors on gene expression within the brain, potentially contributing to suicide vulnerability.. India represents the largest proportion of global suicide deaths, yet the majority of suicide epigenetics research has focused on individuals of Western admixture. Sonication:Article Title: Genome-wide identification of differentially methylated regions in prefrontal cortex of suicide completers in an Indian ancestral admixture population. Article Snippet: Objectives: Suicide is a complex phenotype influenced by genetic, environmental, and psychosocial determinants.. Epigenetic mechanisms, particularly DNA methylation, play a critical role in mediating the long-term effects of environmental stressors on gene expression within the brain, potentially contributing to suicide vulnerability.. India represents the largest proportion of global suicide deaths, yet the majority of suicide epigenetics research has focused on individuals of Western admixture. Qubit:Article Title: Patient-Derived Fibroblasts as a Clinically Relevant Model of Kearns-Sayre Syndrome. Article Snippet: A mtDNA fragment of 16,267 bp was amplified as previously described13 by long-range PCR using the Takara LA PCR kit (Takara) and the forward (50-ACCGCCCGTCACCC TCCTCAAGTATACTTCAAAGG-30) and reverse (50-A CCGCCAGGTCCTTTGAGTTTTAAGCTGTGGCTC G-30) primers. .. Amplicons were quantified using Qubit 2.0 (Invitrogen), and 1,000 ng were fragmented using Magnetic Beads:Article Title: Patient-Derived Fibroblasts as a Clinically Relevant Model of Kearns-Sayre Syndrome. Article Snippet: A mtDNA fragment of 16,267 bp was amplified as previously described13 by long-range PCR using the Takara LA PCR kit (Takara) and the forward (50-ACCGCCCGTCACCC TCCTCAAGTATACTTCAAAGG-30) and reverse (50-A CCGCCAGGTCCTTTGAGTTTTAAGCTGTGGCTC G-30) primers. .. Amplicons were quantified using Qubit 2.0 (Invitrogen), and 1,000 ng were fragmented using Purification:Article Title: Phage homing endonuclease amplifies anti-defense genes to evade bacterial immunity Article Snippet: .. Adapter-ligated DNA was fragmented using the Spectrophotometry:Article Title: Draft genome data of Ochrobactrum anthropi strain Nas42 from estuarine sediments of the Red River Delta, Vietnam Article Snippet: .. Data collection , Genomic DNA of Ochrobactrum anthropi strain Nas42 was extracted from a metal-selective culture of sediments from the Red River Delta (Vietnam), quality-checked by spectrophotometry and agarose gel electrophoresis, and prepared for whole-genome sequencing using the Agarose Gel Electrophoresis:Article Title: Draft genome data of Ochrobactrum anthropi strain Nas42 from estuarine sediments of the Red River Delta, Vietnam Article Snippet: .. Data collection , Genomic DNA of Ochrobactrum anthropi strain Nas42 was extracted from a metal-selective culture of sediments from the Red River Delta (Vietnam), quality-checked by spectrophotometry and agarose gel electrophoresis, and prepared for whole-genome sequencing using the RAST Test:Article Title: Draft genome data of Ochrobactrum anthropi strain Nas42 from estuarine sediments of the Red River Delta, Vietnam Article Snippet: .. Data collection , Genomic DNA of Ochrobactrum anthropi strain Nas42 was extracted from a metal-selective culture of sediments from the Red River Delta (Vietnam), quality-checked by spectrophotometry and agarose gel electrophoresis, and prepared for whole-genome sequencing using the |